Speed- Link Medusa 5. Home Edition (SL- 8. Headset Review. Speed- Link. Based in Germany, Speed- Link is known around Europe for its gaming peripherals and multimedia equipment. The list of product ranges includes mice, gaming surfaces (mousepads), joysticks, gamepad controllers, headsets, steering wheels, and equipment- carrying harnesses and bags. The company even has its own gaming clan, Team Speed- Link, which actively plays both online and at organised LAN party events. Medusa 5. 1 Home Edition. This review is going to be taking a look at Speed- Link's top of the line headset, the Medusa 5. Home Edition. I was intrigued by the surround sound and the overall popularity of the entire Medusa 5. Could a headset deliver 5. Is it better than a stereo headset? Let's find out! Speed- Link Medusa 5. Home Edition (SL- 8. Headset Review » Page 5 - Testing. Testing. Music. Music seemed to be a good starting point for the testing, as I could try out a wide range of tracks that I am very familiar with. I listen to music every day on both my home system, made up of hi- fi separates, speaker and headphones, as well as portable audio including a different set of headphones, mp. Having such a wide range of audio devices and experience working with club sound systems really helped me when assessing and "tuning- in" the myriad of controls available. One of the key aims of this particular area of testing was to bring the headset frequency response as close to my hi- fi separates and portable audio as possible and, at the same time, find the settings that allowed me to drive the headset as loud as possible without distortion. A balance of power, frequency response, and clarity, is something I aim to achieve with all audio equipment and I wasn't going to drop my standards for the Medusa headset. ![]() ![]() Test tracks. I selected a number of music tracks that are particularly loud with very tough bass content to fine tune the sound controls of the soundcard and mp. This selection of tracks produced distortion easier than most other tracks when driving the headset at high volumes and proved to be very useful for fine tuning the bass and EQ settings to allow distortion- free playback of all musical sources. Breaks / Hip- Hop. Baobinga - The Bashment Track. Mr Scruff - Shelf Wobbler. Azzido Da Bass - Dooms Night (Timo Maas Remix)DJ Deekline And Ed Solo - Touch Your Toes. Switch to the UK edition switch to the AU edition switch to the INT edition. Medusa by Michael Dibdin Faber. gregarious detectives with happy home lives who eat and drink any old crap and do everything by the book. Mr Oizo - Flat Beat Drum n Bass. Aphrodite - Chinois. Alex Reece - Pulp Fiction (Lemon D Remix)Brockie & Ed Solo - System Check Hardcore. Nukleuz Kollective Pres Cortina - Take Me Higher (Sy & Unknown Hardcore Mix)Praga Khan - Injected With A Poison (Hixxy Remix)Dougal & Gammer - X- Treme (Exclusive Clubland Remix) Techno. Dub Taylor - Something, Sometimes. The Delta - MJ. Error. Huntemann - Discotech (Monika Kruse @ Voodooamt Remix)Umek - Posing As Me. The musical testing was by no means limited to these tracks and I auditioned the headset for many, many hours over a wide range of music including much less "heavy" tracks that were also demanding in other ways that helped fine- tune the mid to high frequency ranges. Results: optimal settings for Audigy. ZS soundcard. It took some time to adjust the Audigy. ZS's controls to give a slightly better frequency response. The headset is very capable of an energetic and involved performance while maintaining detail and clarity, but a little bit of tweaking is required to supply the amp with just the right input signal to achieve the best sound. With the centre/sub channels connected to the amp normally, I could not achieve a decent balance between the lower frequencies produced by the subwoofer and the front channels. The sub certainly was producing bass, but almost to the point of being sub- sonic! The headset was pulsating with the bass enormously, and yet there was a lot of lower end bass missing. After trying every combination of soundcard settings possible and reading several forums for recommended settings, I tried swapping the centre and sub channels by using a 3. While the bass problem was solved, I therefore "lost" the centre channel as it was now being fed by the subwoofer output. There seems to be a problem with the Audigy 2 drivers in that you have to choose between having a centre channel and zero subwoofer output (bass redirection: off), a centre channel and sub- sonic subwoofer output (bass redirection: on), or no centre channel and balanced subwoofer and other channel bass reproduction. Here are the settings of the soundcard's mixer, bass management, graphic EQ, and surround up- mixing panels: Mixer Volume: 5. Bass: 8. 4%Treble: 5. Speed-Link MEDUSA 5.1 Home Edition Headset: Amazon.co.uk. Average Customer Review. I like audio hub/switch which comes with Medusa Home edition. Medusa 5.1 ProGamer V2 Review. Share. REVIEWS. Batman #2 Review. (the other being the Medusa 5.1 Home Edition), and is designed almost entirely for gaming usage, while the other mixes in more home accessories. We have 6 reviews of Speed-Link Medusa 5.1 Home Edition SL-8796 and the average score is 95%. View all reviews, videos, ratings and awards for speedlinkmedusa51homeeditionsl8796. Find helpful customer reviews and review ratings for Speed-Link MEDUSA 5.1 Home Edition Headset at Amazon.com. Read honest and unbiased product reviews from our users./>. This is an in-depth review and guide to the Speed-Link Medusa 5.1 Home Edition [SL-8796]. It is a high quality headset (with microphone) with 4 speakers built into each cup for true 5.1 surround sound. Hopefully this will be. This review is going to be taking a look at Speed-Link's top of the line headset, the Medusa 5.1 Home Edition. I was intrigued by the surround sound and the overall popularity of the entire Medusa 5.1 series on computer and. Speed-Link Medusa 5.1 Home Edition (SL-8796) Headset Review. hardnrg - February 18, 2007. to the Medusa 5.1 Home headset's credit. NVIDIA GeForce GTX 1070 Founders Edition Review » all reviews. Source (Wave): 7. Graphic EQ 1. 25 Hz: +2. B2. 50 Hz: - 1. 2. B5. 00 Hz: - 1. 0. B1 k. Hz: +1. 1. 0d. B2 k. Hz: +1. 8. 2d. B4 k. Hz: +2. 5. 7d. B8k. Hz: +4. 9. 1d. BPreamp: - 1. 3. 3d. BBass Management Subwoofer volume: 1. Bass redirection: enabled. Crossover frequency: 1. Hz. Creative Multi Speaker Surround (CMSS) Enable CMSS 3. D: enabled. Mode: CMSSStereo focus: 0%Contrary to conventional wisdom, the crossover for the "subwoofer" performs best when set at 1. Hz. Increasing the value only reduces the amount of bass sent to the subwoofer channel! This is because it is actually being driven by the centre channel output. Another odd anomaly is that the amp produces an audible hiss at low volumes (0~2. It is only really noticeable in the 0~1. I had the amp at somewhere around 2. Stereo sources such as mp. Audigy. 2 ZS. CMSS 3. D up- mixing (stereo to 5. CMSS needs to be turned off for movies and games, it's more convenient to just keep CMSS off all the time, and it still sounds great! When CMSS is enabled, the headset has slightly more bass extension thanks to routing the bass to the sub speakers, but the room simulation effect can sound a little strange at times. In short, using the "front" left and right channels alone is only very slightly inferior to using all the channels for music. So if you are lazy like me, you can just leave CMSS disabled (it has to be disabled for listening to true 5. Results: optimal settings for i. River i. FP- 8. 99 MP3 player. As the Medusa headset comes with an adapter for stereo- only sources, I thought it would be interesting to see how they fared without the amp and no 3. D up- mixing / matrixing. Graphic EQ5. 0 Hz: +1. B2. 00 Hz: - 3d. B1 k. Hz: 0d. B3 k. Hz: +3d. B1. 4 k. Hz: +6d. BI think the d. B ratings on the MP3 player's EQ settings are somewhat arbitrary as applying a +1. B boost to a band centred around 5. Hz would normally be asking for trouble. So I think rather the shape of the corrective EQ curve is the most meaningful thing here. It is extremely similar to the EQ settings I use with my Koss Portapro headphones and, to the Medusa 5. Home headset's credit, the sound produced from the headphones is impressively close to that of the Portapro's. The Medusa headset is noticeably quieter at the same volume however, and the bass extension isn't quite as deep. This seems to indicate that the headset would fare better when driven from an amplifier as the same characteristics can be heard when trying to drive Sennheiser HD5. While I had the headset connected to my MP3 player, and since it has a line- in/mic socket, I decided to connect the headset mic and try out the voice recording feature. This MP3 player does real- time encoding up to 3. Hz sample rate. Even at the lowest setting of 3. This initial test proved very promising for the likelihood that the headset mic would be able to provide a high level of sound quality for online voice communication. Movies. After finding the best settings for stereo sources, I was itching to test some true 5. Medusa headset handled multi- channel audio. I selected a number of movies with Dolby Digital 5. Dolby DTS 5. 1 audio that have a range of sounds from soft dialogue, to gunshots, front- to- rear "fly- by" projectile sounds, explosions, and environment acoustics. Here are the movies I chose for testing: Dolby Digital 5. Resident Evil: Apocalypse. Ong Bak. Predator. House of Flying Daggers. Dolby DTS 5. 1. War of the Worlds. The Transporter. Alien: Resurrection. The Descent Reversing the centre and sub channels makes the bass work properly, but also the source's centre channel is routed to the "sub" speakers and therefore is a little bit quiet and muffled. The sub speakers certain extend way above the quoted 1. Hz upper limit and seem to be almost full- range speakers themselves. Connecting the centre and sub channels normally meant the sub's bass was almost non- existent as it seems the Creative driver's bass redirection and crossover does not work as intended. Basically, one way round you get all the sound information but the dialogue is a bit quiet, and the other way round you get a clear centre channel but a significant portion of the bass is missing. The headset's centre and sub speakers are not at fault here, it is the Creative drivers not allowing the correct crossover behaviour. It seems the Creative X- Fi series has different subwoofer behaviour that acts normally when using certain settings, but for the Audigy 2 series, there is no perfect solution. Unfortunately I don't have access to an X- Fi soundcard to test the claims of others. Another solution I came across was to use the 3rd party k. X drivers, so I installed the newest k. X drivers and tried out a few recommended solutions. This proved fruitless so I tried the newest Creative drivers in case they solved any issues. No success whatsoever. This worried me a little, as I didn't think it boded all that well for 5. Vo. IP - Skype, MSN, Ventrilo, Teamspeak. Up next, testing the microphone for levels and also assessing clarity for people listening to me. The sound quality of the microphone was extremely good in all Voice- Over- IP applications and many of the people that I conversed with actually commented on how clear I sounded (compared to before when I used the Creative desktop microphone). One of the biggest differences is that the headset mic picked up my speech and very little background noise, whereas the Creative desktop mic picked up everything in the room including my main computer cooled by 1. The 4 metre cable length quickly proved itself to be very useful during conversations as I could easily get to just about anywhere in my room to find something and not have to take the headset off. Games. Unreal Tournament 2. Prey. Need For Speed: Carbon. Tomb Raider: Legend. Far. Cry. Half- Life 2. Counter- Strike: Source. The last part of the testing I expected to be the most fun, but also the most important, as I would be testing 5. Direct. Sound. 3D and Open. AL multi- channel games, while at the same time being able to converse over Vo.
0 Comments
Freeware Sharing - Pix. Village : : Online Photo Sharing Software : :, AA File Sharing, File Sharing Sentinel. Manolito is a file- sharing program that uses a peer- to- peer network and works without a central server. Search and get free music downloads from the entire network of users. Also offers buddy list, integrated chat, firewall support and CD burner. More Info Download. Http:// 1 20 A Google User. Dev removed. Easy to share your app's link or APK. PixVillage :: Online Photo Sharing Software ::, AA File Sharing, File Sharing Sentinel. Freeware Records 1-20 | Go to. BadBlue Easy File Sharing Server. . online file sharing tools could be a. 20 Extremely Easy to Use Online File Sharing Tools and. we focus on extremely easy to use file sharing tools that. . file storage, sharing and. unlimited storage for 1-20 laptops/desktops, unlimited storage file and type. 10 Easy Ecommerce Social Media Tips for the. ![]() File Sharing Downloads at Download That. Easy File Sharing FTP Server is a easy to use ftp server software. Easy File Sharing FTP Server, BigSpeed File Sharing. Download Xmen Apacolypse 720p.mkv. File Size : 1.20 GB File Type : mkv. Availability : Public. Online file sharing and storage. Easy registration. File upload progressor. Multiple file transfer. Fast download. NAVANA 1. 20 hours ago. File type mp3. BitComet is a BitTorrent/HTTP/FTP download client! (Internet Connection Firewall) and ICS (Internet Connection Sharing). Intelligent File Rename. File sharing program Windows 8 downloads. 1 - 20 of 198. Limerunner is an easy-to-work with p2p file sharing application designed to help you search and. The Climax. (e. Book, Paperback and Hardcover)This is the fourth and penultimate volume in David Roy’s celebrated translation of one of the most famous and important novels in Chinese literature. The Plum in the Golden Vase or, Chin P’ing Mei is an anonymous sixteenth- century work that focuses on the domestic life of Hsi- men Ch’ing, a corrupt, upwardly mobile merchant in a provincial town, who maintains a harem of six wives and concubines. The novel, known primarily for its erotic realism, is also a landmark in the development of the narrative art form—not only from a specifically Chinese perspective but in a world- historical context. This complete and annotated translation aims to faithfully represent and elucidate all the rhetorical features of the original in its most authentic form and thereby enable the Western reader to appreciate this Chinese masterpiece at its true worth.
The Plum in the Golden Vase or. Our eBook editions are available from these online vendors: Amazon Kindle Store; Apple iBooks; Barnes & Noble Nook Store. ![]() 《古典文学极品收藏-梦梅馆定本-金瓶梅词话-影印版》(The.Plum.In.The.Golden.Vase.PHOTOCOPY.iNt.EBOOK) 资源类别 资料-书籍杂志 发布时间 2008-04-05. The Plum in the Golden Vase or. Kindle eBook. it can be semantically construed as The Plum in the Golden Vase, or Plum Blossoms in a Golden Vase. ![]() David Tod Roy is professor emeritus of Chinese literature at the University of Chicago, where he has studied the Chin P’ing Mei and taught it in his classes since 1. Reviews: "[A] book of manners for the debauched. Its readers in the late Ming period likely hid it under their bedcovers."- -Amy Tan, New York Times Book Review. Praise for the previous volumes: "[I]t is time to remind ourselves that The Plum in the Golden Vase is not just about sex, whether the numerous descriptions of sexual acts throughout the novel be viewed as titillating, harshly realistic, or, in Mr. Roy's words, intended 'to express in the most powerful metaphor available to him the author's contempt for the sort of persons who indulge in them.' The novel is a sprawling panorama of life and times in urban China, allegedly set safely in the Sung dynasty, but transparently contemporary to the author's late sixteenth- century world, as scores of internal references demonstrate. The eight hundred or so men, women, and children who appear in the book cover a breath- taking variety of human types, and encompass pretty much every imaginable mood and genre- -from sadism to tenderness, from light humor to philosophical musings, from acute social commentary to outrageous satire."- -Jonathan Spence, New York Review of Books. Praise for previous volumes: "Reading Roy's translation is a remarkable experience."- -Robert Chatain, Chicago Tribune Review of Books. More reviews. Table of Contents. Other Princeton books authored or coauthored by David Tod Roy: Series: Subject Areas. Books, audiobooks and videos for libraries. In this third volume of a planned five- volume series, David Roy provides a complete and annotated translation of the famous Chin P'ing Mei, an anonymous sixteenth- century Chinese novel that focuses on the domestic life of His- men Ch'ing, a corrupt, upwardly mobile merchant who maintains a harem of six wives and concubines. This work, known primarily for its erotic realism, is also a landmark in the development of narrative art—not only from a specifically Chinese perspective but also in a world- historical context. Written during the second half of the sixteenth century and first published in 1. The Plum in the Golden Vase is noted for its surprisingly modern technique. With the possible exception of The Tale of Genji (ca. Don Quixote (1. 60. Although its importance in the history of Chinese narrative has long been recognized, the technical virtuosity of the author, which is more reminiscent of the Dickens of Bleak House, the Joyce of Ulysses, or the Nabokov of Lolita than anything in earlier Chinese fiction, has not yet received adequate recognition. This is partly because all of the existing European translations are either abridged or based on an inferior recension of the text. This translation and its annotation aim to faithfully represent and elucidate all the rhetorical features of the original in its most authentic form and thereby enable the Western reader to appreciate this Chinese masterpiece at its true worth. Replete with convincing portrayals of the darker side of human nature, it should appeal to anyone interested in a compelling story, compellingly told. The Superman Motion Picture Anthology Blu-ray (Superman & Superman Expanded Edition, Superman II & Superman II: The Richard Donner Cut, Superman III, Superman IV: The Quest for Peace, Superman Returns) (1941-2006): Over 20.You must accept our Terms Of Service before continuing. Invalid username. Invalid Email Address. Password doesn't match. Mike Oldfield - Tubular. Archives. Back to recent news. The Tubular. net team sends its heartfelt condolences to Mike and his family upon the passing of Mike's son, Dougal. May you find peace and solace at this challenging and sad time. Friday, 2. 2 May 2. Artists to create fully-realized professional level records in the intimacy of his own home studio. With original recordings executive-produced by Elvis Presley with producer Felton Jarvis (who'd helmed most of Elvis' records. CD has the best price and the best selection of products every day. | Rakuten.co.uk Shopping. 2012/08/08. It's been a while since our last news update at vomitory.net, but we have been quite active during the summer nonetheless. We experienced two absolutely fantastic shows at Hellfest, France in June and at Obscene. Q.What is a subscription and what is it for? A.A Premium subscription allows you to enjoy additional benefits to the free service that Rapidgator.net offers. When you buy Premium subscription, you sign up for auto renewal by. Mike confirmed on BBC Radio 2 he is in the early stages of a Tubular Bells prequel album, that would be released in about 2 years, after the Islands, Earth Moving, Amarok, and Heaven's Open remixes. It would be instrumental, would try not to use digital instruments, sequencers or computer software, and might be released only on vinyl. Thursday, 1. 4 May 2. Rhino has released Mike's 3. The Best of Mike Oldfield: 1. You can order it at Amazon. Amazon. co. uk, etc. The collection is drawn from Oldfield’s eight studio albums released on Warner Bros. Records between 1. Tubular Bells three times. The inclusion of non- album versions, rare edits and radio mixes on the first CD will be welcomed by fans and disc two takes this a step further with various remixes, including The Orb’s “Orbular Bells” mix of Sentinel. Tracklist: Disc One: Singles. Sentinel (Single Restructure)2. Tattoo (Edit)3. The Bell (Mc Viv Stanshall Remix)4. Hibernaculum. 5. Let There Be Light. The Voyager. 7. Women Of Ireland (Lurker Edit)8. Man In The Rain. 9. Far Above The Clouds (Timewriter's Radio Mix)1. Cochise. 11. Out Of Mind. Pacha Mama. 13. Sunlight Shining Through Cloud. Amber Light. 15. To Be Free (Single Remix)1. Thou Art In Heaven (Radio Edit)1. Introduction 2. 00. Single Remix)1. 8. The Sailor's Hornpipe 2. Disc Two: Rarities & Mixes. Early Stages. 2. Silent Night. The Bell (Mc Billy Connolly Remix)4. The Spectral Army. The Song Of The Boat Men. Indian Lake. 7. Mike's Reel. Sentinel (Orbular Bells Mix)9. Let There Be Light (Bt's Pure Luminesence Remix)1. Women Of Ireland (System 7 1. Mix)1. 1. Far Above The Clouds (Jam & Spoon Mix)1. To Be Free (Soultronik Mix- Tical Mix)1. Thou Art In Heaven (Pumpin' Dolls Vs. Mighty Mike Club Mix) [Radio Edit]Sunday, 2. April 2. 01. 51. 4 comments. Caroline Monk posted to Mike's Facebook page on 2. March: "Mike just asked me to tell you all that Discovery and Killing Fields will be coming out soon and one of the disks and vinyl will be called " SUITE 1. Sunday, 2. 2 March 2. A rare opportunity to experience a full performance of Mike Oldfield’s debut album which launched Virgin Records in 1. This one- off concert features a band of over 2. Colchester Institute’s own Head of Digital Media, Phil Toms, and is a must for fans across the country and beyond! Guest performers include film composer Roger Eno as the Master of Ceremonies, West End star Nicole Faraday (The Eva Cassidy Story, Bad Girls) on vocals and lead guitarist Jay Stapley, who performed with Mike Oldfield at the premiere of Tubular Bells II in Edinburgh in 1. Click here for details and tickets. Sunday, 2. 5 January 2. Caroline Monk has announced on Mike's personal Facebook group that Man On the Rocks will be release on August 4th as an EP on i. Tunes with Mike’s single edits for the album: Man On The Rocks Moonshine Sailing Man On Rocks Acoustic Video. Tuesday, 8 July 2. Gonzo Multimedia are preparing to release Howling at the Moon, a recording of the 1. Hyde Park concert by Kevin Ayers and the Whole World. It features Mike Oldfield on bass. The album will be released on June 9th, and can be pre- ordered from the Gonzo website or from all good record shops! Danke, manintherain! Wednesday, 2. 8 May 2. A new album from Tom Newman, The (Secret) Life of Angels is set for release on April 1. As an album of hand- played instrumental music by the producer of albums like Tubular Bells and Amarok, it should be of interest to fans of Tom's work with (and without) Mike! Tom has posted some taster samples on his Soundcloud page, and a video for the track Raphael's Bicycle is available on You. Tube. There are also more samples, plus ordering details, on the Viral Discs and Downloads website. Monday, 1. 4 April 2. We've had an exclusive announcement from Virgin EMI about Mike's next album, which includes plans for a premiere concert: Following Sir Richard Branson's announcement yesterday of Virgin Buildings, where Branson revealed that he had his sights set on the moon, Virgin EMI is proud to announce that Mike Oldfield will be supporting Branson's ambitions with a new album and a spectacular live performance. Called TB- 0, the album will reflect on Mike's contribution to Virgin's space ventures, referring back to his classic debut album, Tubular Bells, which kick- started the Virgin empire. The name also refers to TMA- 0, the monolith in Arthur C Clarke's 2. A Space Odyssey, which begins primitive man's journey towards being a space- faring species."I've always loved space, and I'm a particular fan of Arthur C Clarke," says Mike, "So the concept of combining Tubular Bells with a moon concept and 2. There are three monoliths in 2. I want the album to be in three parts to represent three eras in my own career, as well as in Richard's. I want the first part to be like a prequel to Tubular Bells, using all the old instruments, then the second part will be more modern. I'd like to go back to the sound of my album Crises, because that was also in the era that Richard was starting Virgin Atlantic. The third part will be the space part - my music's just been used by the European Space agency for their Sentinel program, and of course Richard's got Virgin Galactic and his new building plans, so it'll have to represent that. I'm still working on ideas for that. I want it to be a long instrumental work where all three parts fit together and reference each other, so it's like there's a genuine evolution from beginning to end, not just three different things stuck together."Mike also announced plans to accompany the album's launch with a special concert. We want to represent the album by having a transition in the concert as well. We're going to set up a big stage and seating area at Spaceport America, and the audience will stay there, but during the concert, I'll get into one of Richard's spaceships and be launched into space, so the final part will be me playing the bells from space. I used Skype heavily for making my last album, so I had a chat with the people from Skype, and they've agreed to help us do it, so I can be in space and all the audience on the ground will be able to see me on big screens. We've got the European Space Agency cooperating as well, so hopefully we'll be able to have musicians joining us from the International Space Station too. After Chris Hadfield, they've really seen the benefit of having astronauts involved in musical events."Virgin Group founder Sir Richard Branson said "When we released Tubular Bells, over 4. Virgin Galactic is now making commercial spaceflight a reality. Now, we're looking towards the next step of reaching the moon, and we're thrilled to have Mike Oldfield on board to help us with a new album, just like he did with the first Tubular Bells."Tuesday, 1 April 2. Mike is commenting his latest album Man on the Rocks track by track in this video on the official VEVO You. Tube channel (only available in certain countries). Also, Caroline Monk has confirmed that the next single is Moonshine. Update Apr 4: now more broadly available. Monday, 3. 1 March 2. Mike and his two sons send greetings to the European Space Agency and their Sentinel- 1 mission in this video where he also mentions his passion for space, science fiction, and Arthur C. Clarke. Sentinel from Tubular Bells II is the official music for the mission. Wednesday, 1. 2 March 2. A video of an acoustic performance of Man on the Rocks has been released on the via the official VEVO channel on You. Tube. It features Mike and Luke Spiller performing the song together in the Bahamas. Update: We're told that the video is unfortunately unavailable in Germany. Update 1. 9th February: The video seems to have now been changed to private and can't be seen in any country, a couple of messages indicate it might be available again from 2. February. Further update 1. February: It's now available again! A video for the studio version of the track is also available on the VEVO site, though viewers in some countries will be redirected to the acoustic performance video instead. Tuesday, 1. 8 February 2. The video for Sailing is now available to watch on the website of the British newspaper The Daily Telegraph, though unfortunately not in all countries. It'll also be available to buy on i. Tunes from next Tuesday, February 1. More videos of performances from the album by Mike and Luke, as well as a documentary about the album, will be released through official channels in the lead up to the album's release. Monday, 1. 0 February 2. The first five albums by Kevin Ayers have been issued as a low priced 5 CD boxed set by Original Album Series. Mike features heavily on the two albums recorded in the pre- Tubular Bells years, Shooting at the Moon and Whatevershebringswesing, as well as providing a guitar solo on one track of The Confessions of Dr. Dream and Other Stories. Thanks, Chris Mussett. Wednesday, 2. 2 January 2. Post a comment! Tune into BBC Radio 2 just after 1. AM on Tuesday, 1. January to hear the exclusive, full- length first play of "Sailing" from Mike Oldfield's new album Man On The Rocks! Thanks, Caroline Monk! Monday, 1. 3 January 2. More details about Man on the Rocks, including a revised release date of March 3rd, have been revealed by Universal. Alongside the CD and Vinyl editions, there will also be a Deluxe Edition and a Deluxe Boxed Set. The Deluxe Edition includes a second CD of instrumental versions of the album's tracks, in a cardboard fold- out package like the Deluxe Edition reissues. The Deluxe Boxed Set, only available through Universal's Mike Oldfield online store, also includes a third CD containing Mike's demos for the album, as well as alternate mixes of four of the albums tracks (Sailing, Dreaming in the Wind, Following the Angels and I Give Myself Away). It comes with a 1. Buy CD Online | Rakuten. How to Cite the DSM- IV- TR in APA 6th Edition Format. Start your citation with: "American Psychiatric Association." This is the group that puts together and publishes the DSM- IV- TRAdd the date last revised in parenthesis, followed by a period. Add the full title of the publication in italics. Directly after the title add the addition number; you must also mention that the text is a revised edition. This should be formatted as: (4th ed., text rev.) and have a period after the closing parenthesis. Add the publishing city, which is Washington, D. C. and follow that with a period. Double space your citation and indent the second line of your citation. ![]() DSM-5 Implementation and Support. Highlight of Changes from DSM-IV-TR to DSM-5 Attention-Deficit/Hyperactivity Disorder. Arlington, Va. 22209-3901 phone: 703-907-7300 email: [email protected]. How to Cite the DSM–5 in APA Style (UPDATED). If you used the online edition of the DSM. Text citation: (American Psychiatric Association. I am having trouble citing the DSM-IV-TR in APA format. Can you help? Ask Another Question. Then I clicked the 'Cite/Export' button to get the citation. (APA 6th ed. manual p. 203, bullet 2).
Eenadu News Paper | E Paper. ![]() . Read latest eenadu telugu epaper in online easily. Click on news paper front to read today's eenadu online daily. Home Epapers Language Wise USA UK SriLanka Pakistan China Japan Russia Nepal Kenya Hong Kong Australia. Thank you for your session with Eenadu e-paper Do visit us again: Click here to re-login: Privacy Policy | Legal Disclaimer | Trademark. Other Epapers From : Mahabubnagar. PrajaSakthi Mahabubnagar District Today News ePaper Edition; Andhraprabha Mahabubnagar District Today News ePaper Edition; Andhrabhoomi Mahabubnagar District Today News ePaper Edition. Eenadu epaper; eenadu. telugu news paper eenadu epaper telugu news paper today eenadu paper eenadu telugu daily news paper eenadu telugu news paper eenadu telugu news paper district edition enadu telugu news enadu telugu. EENADU - The Heart & Soul of Andhra Pradesh is now available as ePaper. Site best viewed in Microsoft Internet Explorer 8.0, Firefox 22, Netscape 7.2 and above in 1024x768 resolution. Home » Eenadu News ePaper Online » Eenadu News Paper Mahabubnagar District Edition. Category: Eenadu News ePaper Online. Eenadu News Paper Mahabubnagar District Edition. Rating: 3.5 /5 based on 134 reviews Last.Enterprise build 7. ![]() Windows 7 Ultimate Build 7. Activation Key Free Download. Windows 7 Professional Build 7. Full Working Activator. Windows 7 Ultimate Product Key Free Download. Download Windows 7 is one of the best products of the Microsoft, this product works with all PC’s and Laptops, with some ultimate specifications. Windows 7 has.. . ![]()
Windows 7 build 7600 genuine product key and activation. windows 7 build 7600 genuine product key and. com/working-windows-7-product-key/ May 18, 2014 at 6. Windows 7 Build 7600 - Windows is not genuine. Build lab: 7600.win7_gdr.100618-1621. Windows Activation Technologies-->. ![]() Passware: Password recovery software for windows word excel outlook access mdb. Free demos, more. Password recovery and password crack software: for archives (ZIP, RAR, ARJ, ACE), Microsoft Office (Word, Excel, Access, Outlook), Lotus SmartSuite (WordPro, 1-2-3.
PDF Crack Security - program to decrypt protected Adobe Acrobat PDF files. ![]() Adobe Acrobat X Pro Serial Key,Serial Number Plus Crack & Keygen help you to covert all the PDF files. You just put the Serial Number and activate software. Get the download link here. Download Adobe Acrobat XI Pro cracked working as of : Tags: adobe acrobat 11 crack file, adobe acrobat 11 crack only, adobe acrobat 11. Human Plasminogen Activator Inhibitor- 1 (PAI- 1) Deficiency: Characterization of a Large Kindred With a Null Mutation in the PAI- 1 Gene. Abstract. Plasminogen activator inhibitor- 1 (PAI- 1), the primary inhibitor of tissue- and urokinase- type plasminogen activators, is considered a critical regulator of the fibrinolytic system. Plasminogen activator inhibitor type 1 (PAI-1). The human PAI-1 gene is mapped on chromosome 7q21.3-q22. 'Structure of the human plasminogen activator inhibitor 1 gene: nonrandom distribution of introns.'. 'Human plasminogen activator inhibitor-1 (PAI-1). PLASMINOGEN ACTIVATOR INHIBITOR (PAI-1). measure plasminogen activator inhibitor (PAI-1). Human plasminogen activator inhibitor -1 (PAI-1). Plasminogen activator inhibitor 1 (PAI-1). vivo by plasminogen activator inhibitor-1. Plasminogen activator inhibitor 1 (PAI-1) human. We previously reported a child with abnormal bleeding and complete PAI- 1 deficiency caused by a frame- shift mutation in exon 4 of the PAI- 1 gene. The purpose of this study was to provide genetic and clinical data on the extended pedigree of the original proband to better define the phenotype associated with PAI- 1 deficiency. Allele- specific oligonucleotide hybridization was used to genotype individuals, and serum PAI- 1 antigen was measured by enzyme- linked immunosorbent assay. By this approach we have identified 1. ![]()
![]() ![]() ![]() PAI- 1 null allele and 7 homozygous individuals with complete PAI- 1 deficiency. Clinical manifestations of PAI- 1 deficiency were restricted to abnormal bleeding, which was observed only after trauma or surgery in homozygous affected individuals. A spectrum of bleeding patterns was observed, including intracranial and joint bleeding after mild trauma, delayed surgical bleeding, severe menstrual bleeding, and frequent bruising. Fibrinolysis inhibitors, including ε- aminocaproic acid and tranexamic acid, were effective in treating and preventing bleeding episodes. Other than abnormal bleeding, no significant developmental or other abnormalities were observed in homozygous PAI- 1–deficient individuals. Heterozygous PAI- 1 deficiency was not associated with abnormal bleeding, even after trauma or surgery. These observations define the clinical spectrum of PAI- 1 deficiency and provide additional evidence to support the hypothesis that the primary function of plasminogen activator inhibitor- 1 in vivo is to regulate vascular fibrinolysis. PLASMINOGEN ACTIVATOR inhibitor- 1 (PAI- 1) is a fast- acting inhibitor of tissue- type plasminogen activator (t- PA) and urokinase- type plasminogen activator (u- PA). PAI- 1 is a member of the serpin superfamily of protease inhibitors. Like other serpins, PAI- 1 reacts with its cognate proteases to form 1: 1 enzyme- inhibitor complexes that are enzymatically inactive. PAI- 1 is the primary inhibitor of t- PA in plasma. Platelets, vascular endothelial cells, and vascular smooth muscle cells also contain PAI- 1, suggesting that it is an important regulator of fibrinolysis at sites of vascular injury and thrombus formation. Several nonvascular cell types express PAI- 1, and PAI- 1 is abundant in the extracellular matrix. Therefore, PAI- 1 may regulate proteolysis within the extravascular space by inhibiting plasminogen activators and secondary target proteases, such as thrombin. Considerable information regarding the in vivo function of PAI- 1 has been obtained from analyses of PAI- 1–deficient mice generated by homologous recombination in embryonic stem cells. Vascular fibrinolysis is accelerated in PAI- 1−/− mice. In addition, PAI- 1−/− mice are resistant to the development of pulmonary fibrosis after lung injury, supporting the regulation of extravascular processes by PAI- 1. Epidemiologic studies have identified an association between elevated plasma PAI- 1 and thrombotic vascular disease in humans, including myocardial infarction and deep venous thrombosis. Conversely, a few individuals with reduced PAI- 1 expression and excessive bleeding have been described. We previously reported a child with complete PAI- 1 deficiency and abnormal bleeding after trauma and surgery. DNA sequence analysis showed that this individual was homozygous for a dinucleotide insertion within exon 4 of the PAI- 1 gene. The insertion shifted the PAI- 1 reading frame, resulting in premature stop codon formation and the synthesis of a truncated, nonfunctional PAI- 1 protein. Therefore, this child provided a unique opportunity to study the effects of a defined abnormality of PAI- 1 expression on hemostasis. The purpose of this study was to provide a more comprehensive description of the phenotype associated with PAI- 1 deficiency by identifying and characterizing multiple individuals from this pedigree that carry the mutation, and by following affected individuals over a prolonged period of time. MATERIALS AND METHODSAfter obtaining informed consent, peripheral venipuncture was performed and genomic DNA was prepared from leukocytes as described previously. Exon 4 of the PAI- 1 gene was amplified by performing the polymerase chain reaction (PCR), using primers complementary to flanking intron sequences (5′ primer: CCTGACTGCAGCCCTTTGACATACA, 3′ primer: ACATCTAGAGCATTCCCTGTGGTCTTCCTC). PCR products were alkaline denatured and applied to nylon membranes (Hybond- N; Amersham, Arlington Heights, IL) as described previously. Allele- specific oligonucleotide hybridization was used to identify individuals carrying the previously reported null PAI- 1 allele. Labeling and hybridization of wild- type (ACTTACTATAGTTGAA) and mutant (ACTTACTATATAGTTGAA) probes were performed as described previously. Enzyme- linked immunosorbent assay (ELISA) was used to measure PAI- 1 protein concentration in serum samples, using rabbit polyclonal anti–PAI- 1 antibodies. Detailed bleeding histories and physical examinations were performed to determine the pattern and severity of abnormal bleeding in family members. RESULTSThe family described in our original report was of Old Order Amish descent. Because detailed geneologic records had been maintained by family members, it was possible to track ancestors of the proband back through six generations, as shown in Fig 1. Individual III- 3, who is a common ancestor to both parents of the proband, is highly likely to have carried at least one copy of the mutant PAI- 1 allele. This male, born in 1. He also had 8 siblings. We have confirmed by allele- specific oligonucleotide (ASO) hybridization analysis that at least one of his children by his second wife carries the mutation. Therefore, it is possible that this individual, who married into the Amish community, may represent a founder responsible for a relatively high prevalence of the mutant PAI- 1 allele within this restricted population. Fig. 1. Simplified diagram of the extended pedigree identified by the previously reported proband (denoted by arrow). Individuals within each generation (I- VII) are numbered consecutively from left to right (eg, proband is individual VII- 1. Squares and circles represent males and females, respectively. Partially filled symbols represent individuals that carry a single copy of the null PAI- 1 allele (heterozygotes). Completely filled symbols represent individuals that carry two copies of the null allele and are completely PAI- 1 deficient (homozygous affected). Individuals known to be deceased are denoted by a slash mark. Living individuals not genotyped are denoted by an asterisk. Diamonds represent the indicated number of siblings. After establishing the diagnosis of PAI- 1 deficiency in the proband, it was discovered that the brother of her father had married the sister of her mother (Fig 1). Therefore, we performed ASO hybridization analysis to determine if these individuals (ie, VI- 3 and VI- 4) carried the null PAI- 1 allele. As shown in Fig 2, these studies confirmed that each parent carried a single copy of the exon 4 mutation. Analysis of their nine children showed that 5 were homozygous for the mutation, 3 were heterozygotes, and a single child did not carry the mutation. Serum samples were available from 4 of the children that were homozygous for the mutant allele. PAI- 1 antigen was undetectable in these samples, consistent with the DNA- based analysis. Multiple episodes of abnormal bleeding were observed in the 5 homozygous affected individuals in this family (Table 1). These included bleeding into the knee and elbow joints after minor trauma, extensive subperiosteal bleeding after minor jaw trauma, delayed bleeding after surgical repair of an inguinal hernia, prolonged bleeding after tooth extraction, and frequent bruising. Bleeding times of homozygous affected children were normal, and detailed histories showed that spontaneous bleeding (eg, periumbilical bleeding after birth, epistaxis) was not observed in these individuals. One of the affected children was born prematurely secondary to placenta previa. She subsequently was diagnosed with cerebral palsy. However, no other physical or developmental abnormalities were observed in homozygous affected children. Since establishment of the diagnosis, bleeding episodes have been treated effectively with a 5- to 7- day course of oral tranexamic acid or ε- aminocaproic acid. The parents and heterozygous PAI- 1–deficient children in this family had no history of excessive bleeding. Fig. 2. Genotype analysis of a family containing multiple members with complete PAI- 1 deficiency. DNA amplified from exon 4 of each family member was analyzed by ASO hybridization analysis as described. This family also is shown in Fig 1. Pedigree symbols are as described in Fig 1. Table 1. Bleeding Episodes in Individuals With Homozygous PAI- 1 Deficiency. Three additional children have been born to the parents of the original proband since our first report. One child did not carry the mutation, one child was heterozygous, and a third child was homozygous for the mutant allele. The homozygous affected child, a boy, developed irritability and pallor at 4 months of age after striking his head on a table while being carried. The injury was considered trivial by the child's mother, and medical attention was not sought initially. During subsequent evaluation of persistent scalp swelling the child was found to be anemic (hemoglobin [Hgb] level, 7. L) and to exhibit subtle motor abnormalities during neurologic examination. Head computerized tomography showed the presence of a large epidural hematoma, which required surgical drainage. Please, support us by sharing www. Tweet. Put here a software name you are looking serial numbers for, i.
Install Creator, free and safe download. Install Creator 2.0.34: Build customized installers with a visual interface. ![]() ![]() Serial key for Click Team Install Creator Pro 2 can be found and viewed here. We have the largest serial numbers data base. Install Creator 2. Spend your time developing your creations not building the installers. Download the fully functional freeware version of Install Creator and create. Tradução BR Install Creator Pro 2 #44 download. Tradução BR Install Creator Pro 2 #44 2014-06-21 19:59:00.449000 free download. Tradução BR Install Creator Pro. |
Details
AuthorWrite something about yourself. No need to be fancy, just an overview. Archives
October 2016
Categories |