Human Plasminogen Activator Inhibitor- 1 (PAI- 1) Deficiency: Characterization of a Large Kindred With a Null Mutation in the PAI- 1 Gene. Abstract. Plasminogen activator inhibitor- 1 (PAI- 1), the primary inhibitor of tissue- and urokinase- type plasminogen activators, is considered a critical regulator of the fibrinolytic system. Plasminogen activator inhibitor type 1 (PAI-1). The human PAI-1 gene is mapped on chromosome 7q21.3-q22. 'Structure of the human plasminogen activator inhibitor 1 gene: nonrandom distribution of introns.'. 'Human plasminogen activator inhibitor-1 (PAI-1). PLASMINOGEN ACTIVATOR INHIBITOR (PAI-1). measure plasminogen activator inhibitor (PAI-1). Human plasminogen activator inhibitor -1 (PAI-1). Plasminogen activator inhibitor 1 (PAI-1). vivo by plasminogen activator inhibitor-1. Plasminogen activator inhibitor 1 (PAI-1) human. We previously reported a child with abnormal bleeding and complete PAI- 1 deficiency caused by a frame- shift mutation in exon 4 of the PAI- 1 gene. The purpose of this study was to provide genetic and clinical data on the extended pedigree of the original proband to better define the phenotype associated with PAI- 1 deficiency. Allele- specific oligonucleotide hybridization was used to genotype individuals, and serum PAI- 1 antigen was measured by enzyme- linked immunosorbent assay. By this approach we have identified 1. ![]()
![]() ![]() ![]() PAI- 1 null allele and 7 homozygous individuals with complete PAI- 1 deficiency. Clinical manifestations of PAI- 1 deficiency were restricted to abnormal bleeding, which was observed only after trauma or surgery in homozygous affected individuals. A spectrum of bleeding patterns was observed, including intracranial and joint bleeding after mild trauma, delayed surgical bleeding, severe menstrual bleeding, and frequent bruising. Fibrinolysis inhibitors, including ε- aminocaproic acid and tranexamic acid, were effective in treating and preventing bleeding episodes. Other than abnormal bleeding, no significant developmental or other abnormalities were observed in homozygous PAI- 1–deficient individuals. Heterozygous PAI- 1 deficiency was not associated with abnormal bleeding, even after trauma or surgery. These observations define the clinical spectrum of PAI- 1 deficiency and provide additional evidence to support the hypothesis that the primary function of plasminogen activator inhibitor- 1 in vivo is to regulate vascular fibrinolysis. PLASMINOGEN ACTIVATOR inhibitor- 1 (PAI- 1) is a fast- acting inhibitor of tissue- type plasminogen activator (t- PA) and urokinase- type plasminogen activator (u- PA). PAI- 1 is a member of the serpin superfamily of protease inhibitors. Like other serpins, PAI- 1 reacts with its cognate proteases to form 1: 1 enzyme- inhibitor complexes that are enzymatically inactive. PAI- 1 is the primary inhibitor of t- PA in plasma. Platelets, vascular endothelial cells, and vascular smooth muscle cells also contain PAI- 1, suggesting that it is an important regulator of fibrinolysis at sites of vascular injury and thrombus formation. Several nonvascular cell types express PAI- 1, and PAI- 1 is abundant in the extracellular matrix. Therefore, PAI- 1 may regulate proteolysis within the extravascular space by inhibiting plasminogen activators and secondary target proteases, such as thrombin. Considerable information regarding the in vivo function of PAI- 1 has been obtained from analyses of PAI- 1–deficient mice generated by homologous recombination in embryonic stem cells. Vascular fibrinolysis is accelerated in PAI- 1−/− mice. In addition, PAI- 1−/− mice are resistant to the development of pulmonary fibrosis after lung injury, supporting the regulation of extravascular processes by PAI- 1. Epidemiologic studies have identified an association between elevated plasma PAI- 1 and thrombotic vascular disease in humans, including myocardial infarction and deep venous thrombosis. Conversely, a few individuals with reduced PAI- 1 expression and excessive bleeding have been described. We previously reported a child with complete PAI- 1 deficiency and abnormal bleeding after trauma and surgery. DNA sequence analysis showed that this individual was homozygous for a dinucleotide insertion within exon 4 of the PAI- 1 gene. The insertion shifted the PAI- 1 reading frame, resulting in premature stop codon formation and the synthesis of a truncated, nonfunctional PAI- 1 protein. Therefore, this child provided a unique opportunity to study the effects of a defined abnormality of PAI- 1 expression on hemostasis. The purpose of this study was to provide a more comprehensive description of the phenotype associated with PAI- 1 deficiency by identifying and characterizing multiple individuals from this pedigree that carry the mutation, and by following affected individuals over a prolonged period of time. MATERIALS AND METHODSAfter obtaining informed consent, peripheral venipuncture was performed and genomic DNA was prepared from leukocytes as described previously. Exon 4 of the PAI- 1 gene was amplified by performing the polymerase chain reaction (PCR), using primers complementary to flanking intron sequences (5′ primer: CCTGACTGCAGCCCTTTGACATACA, 3′ primer: ACATCTAGAGCATTCCCTGTGGTCTTCCTC). PCR products were alkaline denatured and applied to nylon membranes (Hybond- N; Amersham, Arlington Heights, IL) as described previously. Allele- specific oligonucleotide hybridization was used to identify individuals carrying the previously reported null PAI- 1 allele. Labeling and hybridization of wild- type (ACTTACTATAGTTGAA) and mutant (ACTTACTATATAGTTGAA) probes were performed as described previously. Enzyme- linked immunosorbent assay (ELISA) was used to measure PAI- 1 protein concentration in serum samples, using rabbit polyclonal anti–PAI- 1 antibodies. Detailed bleeding histories and physical examinations were performed to determine the pattern and severity of abnormal bleeding in family members. RESULTSThe family described in our original report was of Old Order Amish descent. Because detailed geneologic records had been maintained by family members, it was possible to track ancestors of the proband back through six generations, as shown in Fig 1. Individual III- 3, who is a common ancestor to both parents of the proband, is highly likely to have carried at least one copy of the mutant PAI- 1 allele. This male, born in 1. He also had 8 siblings. We have confirmed by allele- specific oligonucleotide (ASO) hybridization analysis that at least one of his children by his second wife carries the mutation. Therefore, it is possible that this individual, who married into the Amish community, may represent a founder responsible for a relatively high prevalence of the mutant PAI- 1 allele within this restricted population. Fig. 1. Simplified diagram of the extended pedigree identified by the previously reported proband (denoted by arrow). Individuals within each generation (I- VII) are numbered consecutively from left to right (eg, proband is individual VII- 1. Squares and circles represent males and females, respectively. Partially filled symbols represent individuals that carry a single copy of the null PAI- 1 allele (heterozygotes). Completely filled symbols represent individuals that carry two copies of the null allele and are completely PAI- 1 deficient (homozygous affected). Individuals known to be deceased are denoted by a slash mark. Living individuals not genotyped are denoted by an asterisk. Diamonds represent the indicated number of siblings. After establishing the diagnosis of PAI- 1 deficiency in the proband, it was discovered that the brother of her father had married the sister of her mother (Fig 1). Therefore, we performed ASO hybridization analysis to determine if these individuals (ie, VI- 3 and VI- 4) carried the null PAI- 1 allele. As shown in Fig 2, these studies confirmed that each parent carried a single copy of the exon 4 mutation. Analysis of their nine children showed that 5 were homozygous for the mutation, 3 were heterozygotes, and a single child did not carry the mutation. Serum samples were available from 4 of the children that were homozygous for the mutant allele. PAI- 1 antigen was undetectable in these samples, consistent with the DNA- based analysis. Multiple episodes of abnormal bleeding were observed in the 5 homozygous affected individuals in this family (Table 1). These included bleeding into the knee and elbow joints after minor trauma, extensive subperiosteal bleeding after minor jaw trauma, delayed bleeding after surgical repair of an inguinal hernia, prolonged bleeding after tooth extraction, and frequent bruising. Bleeding times of homozygous affected children were normal, and detailed histories showed that spontaneous bleeding (eg, periumbilical bleeding after birth, epistaxis) was not observed in these individuals. One of the affected children was born prematurely secondary to placenta previa. She subsequently was diagnosed with cerebral palsy. However, no other physical or developmental abnormalities were observed in homozygous affected children. Since establishment of the diagnosis, bleeding episodes have been treated effectively with a 5- to 7- day course of oral tranexamic acid or ε- aminocaproic acid. The parents and heterozygous PAI- 1–deficient children in this family had no history of excessive bleeding. Fig. 2. Genotype analysis of a family containing multiple members with complete PAI- 1 deficiency. DNA amplified from exon 4 of each family member was analyzed by ASO hybridization analysis as described. This family also is shown in Fig 1. Pedigree symbols are as described in Fig 1. Table 1. Bleeding Episodes in Individuals With Homozygous PAI- 1 Deficiency. Three additional children have been born to the parents of the original proband since our first report. One child did not carry the mutation, one child was heterozygous, and a third child was homozygous for the mutant allele. The homozygous affected child, a boy, developed irritability and pallor at 4 months of age after striking his head on a table while being carried. The injury was considered trivial by the child's mother, and medical attention was not sought initially. During subsequent evaluation of persistent scalp swelling the child was found to be anemic (hemoglobin [Hgb] level, 7. L) and to exhibit subtle motor abnormalities during neurologic examination. Head computerized tomography showed the presence of a large epidural hematoma, which required surgical drainage.
0 Comments
Leave a Reply. |
Details
AuthorWrite something about yourself. No need to be fancy, just an overview. Archives
October 2016
Categories |